What Is the Reading Frame of a Gene

Translation and Open Reading Frame Search

Regions of DNA that encode proteins are first transcribed into messenger RNA then translated into protein.  Past examining the DNA sequence lone nosotros can decide the sequence of amino acids that volition appear in the final protein.  In translation codons of iii nucleotides determine which amino acid will be added side by side in the growing protein concatenation.  It is important then to determine which nucleotide to start translation, and when to cease, this is called an open reading frame.

One time a factor has been sequenced it is of import to determine the right open reading frame (ORF).  Every region of Deoxyribonucleic acid has six possible reading frames, iii in each direction. The reading frame that is used determines which amino acids will be encoded by a gene. Typically only one reading frame is used in translating a gene (in eukaryotes), and this is often the longest open up reading frame. Once the open reading frame is known the DNA sequence tin be translated into its corresponding amino acid sequence.  An open up reading frame starts with an atg (Met) in virtually species and ends with a stop codon ( taa , tag or tga ).

For example, the following sequence of Dna can be read in half-dozen reading frames.  Iii in the forrard and 3 in the contrary direction.  The iii reading frames in the frontwards direction are shown with the translated amino acids below each  DNA seqeunce.  Frame 1 starts with the " a ", Frame ii with the " t " and Frame three with the " yard ".  Terminate codons are indicated by an " * " in the protein sequence.  The longest ORF is in Frame 1.   5'                                                   iii'
atg cccaagctgaatagcgtagaggggttttcatcatttgaggacgatgta taa

1

a tg ccc aag ctg aat agc gta gag ggg ttt tca tca ttt gag gac gat gta taa
    M   P   K   Fifty   N   Due south   5   E   One thousand   F   S   S   F   E   D   D   V *
ii t gc cca agc tga ata gcg tag agg ggt ttt cat cat ttg agg acg atg tat
     C   P   South *    I   A *   R   G   F   H   H   Fifty   R   T   1000   Y
three chiliad cc caa gct gaa tag cgt aga ggg gtt ttc atc att tga gga cga tgt ata
      A   Q   A   E *    R   R   G   V   F   I   I *    G   R   C   I

Practice Problems and a Translation Lecture Tutorial are located in the Theory Section.

DNA Translation .

To translate a Dna sequence, we apply the program called SIXFRAME on the Biology Workbench.  Or y'all can visit the site directly http://searchlauncher.bcm.tmc.edu/seq-util/Options/sixframe.html

1.  Enter Biology Workbench and Resume or Create a New Session.

ii.  Select Nucleic Tools and and so Select the sequence that you wish to interpret by checking the box next to the file.

3.  Select SIXFRAME and then select Run.

4.  You will be given a box asking you to select various parameters.  The default is to translate all six reading frames of the unabridged Deoxyribonucleic acid sequence.  If you lot select ``Prove longest open up reading frame" the plan will automatically select the longest reading frame starting with a start codon (ATG) and ending with a end codon (TAA, TAG or TGA).  This is very handy.

5.  Once the parameters are chosen select Submit.

 Interpretation of Results

1. All vi reading frames will be shown.  Stop codons will be indicated past an asterix (*).
2. At the bottom of the page you will see the ``Longest ORF".  To import this translation of your Dna, click off all of the other boxes next to each reading frame and leave the box adjacent to the longest ORF selected.  So select Import Sequence.
3. A new file with the translated amino acrid sequence volition appear nether Protein Tools.

   

colemanwitand.blogspot.com

Source: http://bioweb.uwlax.edu/GenWeb/Molecular/Seq_Anal/Translation/translation.html

Share this post